Human Copine I / CPN1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGB768-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1614bp
Gene Synonym
RP1-309K20.2, COPN1, CPN1, MGC1142, CPNE1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human copine I Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein which has a wide tissue distribution. Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. Copine I contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus, while it does not contain a predicted signal sequence or transmembrane domains. Copine I may function in membrane trafficking.
References
  • Cowland JB, et al. (2003) Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol. 74(3):379-88.
  • Tomsig JL, et al. (2003) Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem. 278 (12):10048-54.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • TOP