Human Complement Component C2 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:HGB757-CH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2259bp
Gene Synonym
C2, CO2, DKFZp779M0311
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human complement component 2 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.
References
  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.
  • TOP