Human Complement component 7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC063851

RefSeq ORF Size

2532bp

Gene Synonym

C7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human complement component 7 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.

References

Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.

Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.

Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.

Catalog Number:HGB756-CM