Rat Complement C1s Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_138900.1

RefSeq ORF Size

2133 bp

Gene Synonym

r-gsp

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat complement component 1, s subcomponent Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

KpnI + XbaI(6kb+2.13kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Complement is an integral component of the adaptive and innate immune systems and represents one of the major effector systems for the immune responses. The classical complement pathway is triggered by C1, a complex composed of the binding protein C1q and two proenzymes, C1r and C1s. Upon binding of IgG to the head of C1q, C1r undergoes autoactivation and in turn cleaves and activates C1s. C1r and C1s, the proteases responsible for activation and proteolytic activity of the C1 complex of complement, share similar overall structural organizations featuring five nonenzymic protein modules (two CUB modules surrounding a single EGF module, and a pair of CCP modules) followed by a serine protease domain. Besides highly specific proteolytic activities, both proteases exhibit interaction properties associated with their N-terminal regions. In contrast, C1r and C1s widely differ from each other by their glycosylation patterns: both proteins contain Asn-linked carbohydrates, but four glycosylation sites are present on C1r, and only two on C1s. As a highly specific serine protease, C1s executes the catalytic function of the C1 complex: the cleavage of C4 and C2, and thus instigates a sequence of activation steps of other components of the complement system, culminating in the formation of the membrane attack complex which induces cell lysis. Like other complement serine proteases C1s has restricted substrate specificity and it is engaged into specific interactions with other subcomponents of the complement system. The only other protein known to interact with C1s physiologically is SerpinC1, an inhibitor of serine protease, which inhibits C1s activity and thus plays a regulatory role in controlling the function of C1s enzyme.

References

Arlaud GJ, et al. (1989) Structure and function of C1r and C1s: current concepts. Behring Inst Mitt. (84): 56-64.

Thielens NM, et al. (1999) Structure and functions of the interaction domains of C1r and C1s: keystones of the architecture of the C1 complex. Immunopharmacology. 42(1-3): 3-13.

Gl P, et al. (2002) C1s, the protease messenger of C1. Structure, function and physiological significance. Immunobiology. 205(4-5): 383-94.

Catalog Number:HGB755-NM