Human COMMD8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGB752-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
552bp
Gene Synonym
COMMD8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human COMM domain containing 8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
COMMD8 is a member of the COMMD family. Members of this family are a group of evolutionary conserved proteins that share a common COMM domain at the extreme C-terminus, which provides an interface for protein-protein interactions. Most COMMD proteins play a role in the regulation of NF˚B and, despite their similarities, seem to function in unique and non-redundant pathways. COMMD proteins may also play a role in the function of epithelial sodium channels, cell proliferation, copper homeostasis and in the regulation of the ubiquitin pathway. COMMD8 also contains 1 COMM domain and is widely expressed with highest expression in thyroid.
References
  • Danielsen JM. et al., 2011, Mol Cell Proteomics. 10 (3): M110.003590.
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • TOP