Mouse Cochlin Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007728.5

RefSeq ORF Size

1659bp

Gene Synonym

AW122937, Coch-5B2, D12H14S564E, Coch

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse coagulation factor C homolog (Limulus polyphemus) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cochlin, also known as COCH-5B2 and COCH, is a secreted protein which contains one LCCL domain and two VWFA domains. It is an abundant inner ear protein expressed as multiple isoforms. Its function is also unknown, but it is suspected to be an extracellular matrix component. Cochlin and type II collagen are major constituents of the inner ear extracellular matrix, and Cochlin constitutes 70% of non-collagenous protein in the inner ear, the cochlin isoforms can be classified into three subgroups, p63s, p44s and p40s. The expression of cochlin is highly specific to the inner ear. Eleven missense mutation and one in-frame deletion have been reported in the COCH gene, causing hereditary progressive sensorineural hearing loss and vestibular dysfunction, deafness autosomal dominant type 9 (DFNA9). The co-localization of cochlin and type II collagen in the fibrillar substance in the subepithelial area indicate that cochlin may play a role in the structural homeostasis of the vestibule acting in concert with the fibrillar type II collagen bundles. Defects in COCH may contribute to Meniere disease which is an autosomal dominant disorder characterized by hearing loss associated with episodic vertigo.

References

Ikezono T, et al. (2005) Expression of cochlin in the vestibular organ of rats. ORL J Otorhinolaryngol Relat Spec. 67(5): 252-8.

Shindo S, et al. (2008) Spatiotemporal expression of cochlin in the inner ear of rats during postnatal development. Neurosci Lett. 444(2): 148-52.

Hosokawa S, et al. (2010) Ultrastructural localization of cochlin in the rat cochlear duct. Audiol Neurootol. 15(4): 247-53.

Catalog Number:HGB730-NF