Human CNPY4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB708-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747bp
Gene Synonym
PRAT4B, CNPY4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human canopy 4 homolog (zebrafish) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.
References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • TOP