Rat CMPK1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGB680-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
684bp
Gene Synonym
CK, Cmpk, RGD1310116
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cytidine monophosphate (UMP-CMP) kinase 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.
References
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • TOP