Mouse cIAP1/BIRC2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGB585-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1839bp
Gene Synonym
Api1, Api2, IAP1, IAP2, MIHB, MIHC, Birc3, HIAP1, HIAP2, MIAP1, MIAP2, RNF48, cIAP1, cIAP2, mcIAP1, AW146227, Birc2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse baculoviral IAP repeat-containing 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteinsare (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiqitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.
References
  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
  • TOP