Human CHL1/LICAM2/CALL Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_006614.2

RefSeq ORF Size

3675bp

Gene Synonym

CHL1, CALL, L1CAM2, FLJ44930, MGC132578

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

HindIII + XhoI

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

References

Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.

Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.

Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.

Catalog Number:HGB550-CO