Mouse CHI3L1/YKL40 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB542-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Gene Synonym
AW208766,Brp39,Gp39
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chitinase 3-like 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + XbaI(6kb+1.18kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.
References
  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • TOP