Human CES3/Carboxylesterase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_024922.4

RefSeq ORF Size

1716bp

Gene Synonym

ES31, FLJ21736, CES3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human carboxylesterase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

References

Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.

Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.

Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.

Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.

Chen R. et al., 2009, J Proteome Res. 8: 651-61.

Catalog Number:HGB518-NY