Human CEBPG / CEBP gamma Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB487-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
453bp
Gene Synonym
GPE1BP, IG/EBP-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CCAAT/enhancer binding protein (C/EBP), gamma Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members of this family regulate viral and cellular CCAAT/enhancer element-mediated transcription. CEBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. CEBPG binds to the enhancer element PRE-I of the IL-4 gene. It Might change the DNA-binding specificity of other transcription factors and recruit them to unusual DNA sites.
References
  • Thomassin H. et al., 1992, Nucleic Acids Res. 20 (12): 3091-8.
  • Nishizawa M. et al., 1992, FEBS Lett. 299 (1): 36-8.
  • Williams SC. et al., 1991, Genes Dev. 5 (9): 1553-67.
  • Melchionna R. et al., 2012, J Invest Dermatol. 132 (7): 1908-17.
  • TOP