Human CEACAM8/CD66b/CD67 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:HGB485-NG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Gene Synonym
CD66b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carcinoembryonic antigen-related cell adhesion molecule 8 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
KpnI + XbaI(6kb+1.04kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to the carcinoembryonic antigen family. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM8(CD66b) is also an activation marker for human granulocytes. However, its biological functions are largely unknown in eosinophils. It has been reported that CD66b is highly expressed on the surface of human peripheral blood eosinophils isolated from healthy individuals. Engagement of CD66b by mAb or a natural ligand, galectin-3, activated a Src kinase family molecule, hemopoietic cell kinase (Hck), and induced cellular adhesion, superoxide production, and degranulation of eosinophils. CD66b molecules were localized in lipid rafts, and disruption of lipid rafts or removal of the GPI anchor inhibited the adhesion and activation of eosinophils. Importantly, CD66b was constitutively and physically associated with a beta2 integrin, CD11b, and cross-linking of CD66b induced a striking clustering of CD11b molecules. Thus, CD66b molecules are involved in regulating adhesion and activation of eosinophils, possibly through their localization in lipid rafts and interaction with other cell surface molecules, such as CD11b. Binding of exogenous or endogenous carbohydrate ligands(s) to CD66b may be important in the release of proinflammatory mediators by human eosinophils.
References
  • Yoon J, et al. (2007) CD66b regulates adhesion and activation of human eosinophils. J Immunol. 179 (12): 8454-62.
  • Skubitz KM, et al. (1996) CD6a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. J Leukoc Biol. 60 (1): 106-17.
  • Skubitz KM, et al. (2008) Inte rdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. J Transl Med. 6: 78.
  • Lasa A, et al. (2008) High expression of CEACAM6 and CEACAM8 mRNA in acute lymphoblastic leukemias. Ann Hematol. 87 (3): 205-11.
  • TOP