Human CEACAM5/CEA/CD66e Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_004363.2

RefSeq ORF Size

2094bp

Gene Synonym

CEA, CD66e, DKFZp781M2392, CEACAM5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human carcinoembryonic antigen-related cell adhesion molecule 5 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

KpnI + XbaI (6kb + 2.14kb)

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 180 kDa comprising 60% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.

References

Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.

Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.

Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.

Catalog Number:HGB484-CF