Human CDCP1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB443-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
CD318, TRASK, SIMA135, CDCP1p
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CUB domain containing protein 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed in some human cancer cells and in both, typical and atypical (cancerous) colons. It interacts with CDH2/N-cadherin, CDH3/P-cadherin, SDC1/syndecan-1, SDC4/syndecan-4 and the serine protease ST14/MT-SP1. It also interacts with SRC and PRKCG/protein kinase C gamma. CDCP1 is taken as a key regulator of EGF/EGFR-induced cell migration. It has been shown that signaling via EGF/EGFR induces migration of ovarian cancer Caov3 and OVCA420 cells with concomitant up-regulation of CDCP1 mRNA and protein. Consistent with a role in cell migration CDCP1 relocates from cell-cell junctions to punctate structures on filopodia after activation of EGFR. It may be involved in cell adhesion and cell matrix association. It also may play a role in the regulation of anchorage versus migration or proliferation versus differentiation via its phosphorylation. It has been taken as a novel marker for leukemia diagnosis and for immature hematopoietic stem cell subsets.
References
  • Conze T, et al.. (2003) CDCP1 is a novel marker for hematopoietic stem cells. Ann N Y Acad Sci. 996 (1): 222-6.
  • Hooper JD, et al. (2003) Subtractive immunization using highly metastatic human tumor cells identifies SIMA135/CDCP1, a 135 kDa cell surface phosphorylated glycoprotein antigen. Oncogene. 22(12): 1783-94.
  • Scherl-Mostageer M, et al. (2001) Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Oncogene. 20(32):4402-8.
  • TOP