Mouse CD97 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

AF146344.1

RefSeq ORF Size

2175bp

Gene Synonym

TM7LN1, AA409984, Cd97

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse adhesion G protein-coupled receptor E5 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD97 is a receptor predominantly expressed in leukocytes and belongs to a new group of seven-span transmembrane molecules, which is also designed EGF-TM7 family. The family members are characterized by an extended extracellular region with several N-terminal epidermal growth factor-like domains two of which contain a calcium binding site. Muture CD 97 has two noncovalently associated subunits and is composed of a large extracellular protein (CD97 alpha) and a seven-membrane spanning protein (CD97 beta). CD97 is considered as a defining feature of G protein-coupled receptors. The effects that lymphocytes and erythrocytes adere to CD97-transfected COS cells suggest that CD97 has the ability to bind cellular ligands. CD97 alpha has three alternatively spliced isforms that are related to the calium binding EGF-like repeats in the microfibril protein fibrillin. Leukocytes strongly positive for CD97 are concentrated at sites of inflammation relative to CD97 expression in normal lymphoid tissues.

References

Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.

Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.

Gray JX, et al. (1996) CD97 is a processed, seven-transmembrane, heterodimeric receptor associated with inflammation. The journal of Immunology. 157 (12): 5438-47.

Hamann J,et al. (1998) Characterization of the CD55 (DAF)-binding site on the seven-span transmembrane receptor CD97.European Journal of Immunology. 28 (5): 1701-7.

Catalog Number:HGB407-CO