Rat CD69 / CLEC2C Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGB378-UT

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
600bp
Gene Synonym
Cd69
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd69 molecule Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.
References
  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • TOP