Human CD47 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB359-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
972bp
Gene Synonym
IAP; OA3; MER6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD47 molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.
References
  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • TOP