Rat CD3g/CD3 gamma Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB349-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
549bp
Gene Synonym
Cd3g
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD3 molecule, gamma Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.
References
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
  • TOP