Human CD34 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGB341-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1158bp
Gene Synonym
CD34
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD34 molecule, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
KpnI + XbaI (6kb + 1.16kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.
References
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • TOP