Rat CD157/BST1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_030848.1

RefSeq ORF Size

960bp

Gene Synonym

Bst1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat bone marrow stromal cell antigen 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD157, also known as ADP-ribosyl cyclase 2, is an ectoenzyme sharing several characteristics with ADP-ribosyl cyclase CD38. CD157 was originally identified as a bone marrow stromal cell molecule (BST-1) with a glycosylphosphatidylinositol (GPI) anchor to bind to the cell surface. CD157 is prevalently expressed by cells of the myeloid lineage. CD157 could act as a receptor with signal transduction capability. Further, it regulates calcium homeostasis and promotes polarization in neutrophils and mediates superoxide (O₂₋) production in the human U937 myeloid line.

References

Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.

Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.

Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.

Malavasi F, et al. (2006) CD38 and CD157 as Receptors of the Immune System: A Bridge Between Innate and Adaptive Immunity. Molecular Medicine. 12 (11-12): 334-41.

Ortolan E, et al. (2002) CD157, the janus of CD38 but with a unique personality. Cell Biochemistry and Function. 20 (4): 309-22.

Catalog Number:HGB281-NO