Human CD155/PVR transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGB280-CG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1119bp
Gene Synonym
CD155, PVS, HVED, PVR, NECL5, TAGE4, Necl-5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human poliovirus receptor (PVR),transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.
References
  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.
  • TOP