Human CD155/PVR transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_006505.3

RefSeq ORF Size

1254bp

Gene Synonym

CD155, PVS, HVED, PVR, NECL5, TAGE4, Necl-5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human poliovirus receptor (PVR),transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.

References

Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.

Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.

Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.

Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.

Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.

Catalog Number:HGB279-NM