Human CCL22/MDC Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGB219-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282bp
Gene Synonym
CCL22, MDC, ABCD-1, SCYA22, STCP-1, DC/B-CK, MGC34554, A-152E5.1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 22 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chemokine (C-C motif) ligand 22(ABCD-1 / CCL22)is a kind of CC chemokine which is a family of secreted proteins involved in immunoregulatory and inflammatory processes. The cytokine displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. This ABCD-1 / CCL22 chemokine binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated / effector T lymphocytes to inflammatory sites and other aspects of activated T-lymphocyte physiology. ABCD-1 / CCL22 is highly expressed in macrophage and in monocyte-derived dendritic cells, and thymus, and in Langerhans' cell histiocytosis and atopic dermatitis but not in dermatopathic lymphadenopathy. This chemokine is also found in lymph node, appendix, activated monocytes, resting and activated macrophages. This protein is lower expressed in lung and spleen and very weekly expressed in small intestine.
References
  • Vulcano M, et al. (2001) Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo. Eur J Immunol. 31(3): 812-22.
  • Kwon DJ, et al. (2011) Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-?B and STAT1 activation in HaCaT cells. Biochem Biophys Res Commun. 417(4):1254-9.
  • Hirota T, et al. (2011) Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies. PLoS One. 6(11):e26987.
  • TOP