Human CCDC134 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGB183-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
690bp
Gene Synonym
FLJ22349, MGC21013, dJ821D11.3, CCDC134
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human coiled-coil domain containing 134 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Coiled-coil domain containing 134 (CCDC134) is a 229 amino acids secretory protein. Coiled-coil domain is a motif in which alpha-helix are coiled together. It has been found in many types of proteins, including transcription factors, intermediate filaments and certain tRNA synthetases. Many proteins containing such motif CCDC134 are involved in important biological functions. CCDC134 is also considered as a novel human MAPK-regulating protein that can inhibit the MAPK pathway. This protein significantly inhibite Elk1 transcriptional activity. The coiled-coil domain is a ubiquitous protein motif that is often involved in oligomerization.
References
  • Huang J, et al. (2007) CCDC134, a novel secretory protein, inhibits activation of ERK and JNK, but not p38 MAPK. Cellular and Molecular Life Sciences. 65(2): 338-49.
  • Kim S, et al. (2011) Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. Neurology. 76(1): 69-79.
  • TOP