Human Cathepsin V/Cathepsin L2/Preproprotein Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_001333.2

RefSeq ORF Size

1005bp

Gene Synonym

CTSL2, CTSU, CTSV, CATL2, MGC125957

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human Homo sapiens cathepsin L2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase C1 family. It is predominantly expressed in the thymus and testis. Cathepsin V is also expressed in corneal epithelium, and to a lesser extent in conjuctival epithelium and skin. It is a lysosomal cysteine proteinase that may play an important role in corneal physiology. It has about 75% protein sequence identity to murine cathepsin L. The fold of this enzyme is similar to the fold adopted by other members of the papain superfamily of cysteine proteases. Cathepsin V has been recently described as highly homologous to Cathepsin L and exclusively expressed in human thymus and testis. Cathepsin V is the dominant cysteine protease in cortical human thymic epithelial cells, while Cathepsin L and Cathepsin S seem to be restricted to dendritic and macrophage-like cells. Active Cathepsin V in thymic lysosomal preparations was demonstrated by active-site labeling. Recombinant Cathepsin V was capable of converting Ii into CLIP efficiently, suggesting that it is the protease that controls the generation of alphabeta-CLIP complexes in the human thymus. Cathepsin V is the third elastolytic cysteine protease which exhibits the most potent elastase activity yet described among human proteases and that it is present in atherosclerotic plaque specimens. Cathepsin L2 may play a specialized role in the thymus and testis. Expression analysis of cathepsin L2 in human tumors revealed a widespread expression in colorectal and breast carcinomas but not in normal colon or mammary gland or in peritumoral tissues. Cathepsin L2 was also expressed by colorectal and breast cancer cell lines as well as by some tumors of diverse origin, including ovarian and renal carcinomas.

References

Itoh R, et al. (1999) Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 6(2): 137-40.

Tolosa E, et al. (2003) Cathepsin V is involved in the degradation of invariant chain in human thymus and is overexpressed in myasthenia gravis. J Clin Invest. 112(4): 517-26.

Yasuda Y, et al. (2004) Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 279(35): 36761-70.

Puzer L, et al. (2008) Cathepsin V, but not cathepsins L, B and K, may release angiostatin-like fragments from plasminogen. Biol Chem. 389(2): 195-200.

Catalog Number:HGB147-CF