Mouse CANT1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGB082-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1212bp
Gene Synonym
Apy1h; Shapy; Entpd8; SCAN-1; D11Bwg0554e; 5830420C20Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse calcium activated nucleotidase 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can also activate it) (EC 3.6.1.5) that catalyses the hydrolysis of ATP to yield AMP and inorganic phosphate. Two isoenzymes are found in commercial preparations from S. tuberosum. One with a higher ratio of substrate selectivity for ATP: ADP and another with no selectivity. It can also act on ADP and other nucleoside triphosphates and diphosphates with the general reaction being NTP -> NDP + Pi -> NMP + 2Pi. The salivary apyrases of blood-feeding arthropods are nucleotide hydrolysing enzymes are implicated in the inhibition of host platelet aggregation through the hydrolysis of extracellular adenosine diphosphate. CANT1 functions as a calcium-dependent nucleotidase with a preference for UDP. Defects in CANT1 are the cause of desbuquois dysplasia.
References
  • Failer BU, et al. (2002) Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase. J Biol Chem. 277(40):36978-86.
  • Smith TM, et al. (2002) Cloning, expression, and characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a new family of extracellular nucleotidases. Arch Biochem Biophys. 406(1):105-15.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • TOP