Human Calmodulin 2 / CALM2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGB054-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
450bp
Gene Synonym
PHKD, CAMII, PHKD2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human calmodulin 2 (phosphorylase kinase, delta) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.
References
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • TOP