Human CABP3/CABP5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGB025-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
522bp
Gene Synonym
CABP3, CABP5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human calcium binding protein 5 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of CABP3 gene is retina-specific. The mouse homolog of CABP3 has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of CABP3 gene is unknown. Study of the transcripts and genomic structure revealed that the 5 end of this gene is complementary and reverse to that of the CABP5 gene, and the sequence beyond the overlapping region is nearly identical to that of CABP5. Thus, these two genes encode the protein products with distinct N-terminal halves but identical C-terminal halves. CABP3 inhibits calcium-dependent inactivation of L-type calcium channel and shifts voltage dependence of activation to more depolarized membrane potentials. It is also involved in the transmission of light signals.
References
  • McCauliffe DP, et al. (1990) A human Ro/SS-A autoantigen is the homologue of calreticulin and is highly homologous with onchocercal RAL-1 antigen and an aplysia memory molecule. J Clin Invest. 86(1):332-5.
  • Beutler E, et al. (1997) HLA-H and associated proteins in patients with hemochromatosis. Mol Med. 3(6):397-402.
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • TOP