Mouse C1QBP/HABP1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGA972-CG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
840bp
Gene Synonym
P32, HABP1, gC1qBP, AA407365, AA986492, D11Wsu182e, C1qbp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent binding protein Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated in cell signalling. Hyaluronan-binding protein 1 (HABP1) /p32/gC1qR was characterized as a highly acidic and oligomeric protein, which binds to different ligands like hyaluronan, C1q, and mannosylated albumin. The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro. HABP1 overexpressing cells showed extensive vacuolation and reduced growth rate, which was corrected by frequent medium replenishment. Further investigation revealed that HABP1 overexpressing cells undergo apoptosis, and they failed to enter into the S-phase. The sperm surface HABP1 level can be correlated with the degree of sperm motility.Hyaluronan binding protein 1 (HABP1) was reported to be present on human sperm surface and its involvement in fertilization has already been elucidated: decreased HABP1 level may be associated with low motility of sperms, which in turn might cause infertility in the patient. HABP1 also is an endogenous substrate for MAP kinase and upon mitogenic stimulation it is translocated to the nucleus in a MAP kinase-dependent manner.
References
  • Meenakshi J, et al. (2003) Constitutive expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR) in normal fibroblast cells perturbs its growth characteristics and induces apoptosis. Biochemicaland Biophysical Research Communication. 300(3): 686-93.
  • Majumdar M, et al. (2002) Hyaluronan Binding Protein 1 (HABP1) /C1QBP/p32 Is an Endogenous Substrate for MAP Kinase and Is Translocated to the Nucleus upon Mitogenic Stimulation. Biochemical and Biophysical Research Communications. 291(4): 829-37.
  • Ghosh I, et al. (2002) Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. Journal of Reproductive Immunology. 53(1-2): 45-54.
  • TOP