Human BTN2A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC017497

RefSeq ORF Size

1011bp

Gene Synonym

BTF2, BT2.2, BTN2A2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human butyrophilin, subfamily 2, member A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The human and mouse genes encoding butyrophilin-2A2 (BTN2A2) are regulated by the class II trans-activator and regulatory factor X, two transcription factors dedicated to major histocompatibility complex class II expression, suggesting a role in T cell immunity. To address this, Btn2a2-deficient mice are generated. Btn2a2−/− mice exhibited enhanced effector CD4+ and CD8+ T cell responses, impaired CD4+ regulatory T cell induction, potentiated antitumor responses, and exacerbated experimental autoimmune encephalomyelitis. Altered immune responses were attributed to Btn2a2 deficiency in antigen-presenting cells rather than T cells or nonhematopoietic cells. These results provide the first genetic evidence that BTN2A2 is a co-inhibitory molecule that modulates T cell–mediated immunity.

References

Sarter K, Leimgruber E, Gobet F, et al. Btn2a2, a T cell immunomodulatory molecule coregulated with MHC class II genes. The Journal of Experimental Medicine. 2016;213(2):177-187.

Catalog Number:HGA893-CF