Human BPIFB1 / LPLUNC1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA859-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1455bp
Gene Synonym
RP5-1187J4.9, C20orf114, LPLUNC1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human BPI fold containing family B, member 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. BPIFB1 is expressed in the upper respiratory tract and oral cavity, which may function in host defence. The expression of BPIF proteins is associated with CF lung disease in humans and mice. It is unclear if this elevation of protein production, which results from phenotypic alteration of the cells within the diseased epithelium, plays a role in the pathogenesis of the disease. BPIFB1 is an abundant, secreted product of goblet cells and minor mucosal glands of the respiratory tract and oral cavity and suggest that the protein functions in the complex milieu that protects the mucosal surfaces in these locations.
References
TOP