Mouse beta-Catenin/CTNNB1 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:HGA799-CH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2346bp
Gene Synonym
Mesc, Catnb, Ctnnb1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse catenin (cadherin associated protein), beta 1 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have multiple copies of the so-called armadillo repeat domain, which is specialized for protein-protein binding. It is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. CTNNB1 also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, beta-Catenin binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Defects in beta-Catenin can cause colorectal cancer, pilomatrixoma (PTR), medulloblastoma, and ovarian cancer. CTNNB1 is a key dowstream component of the canonical Wnt signaling pathway. In the absence of Wnt, it forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome. In the presence of Wnt ligand, beta-Catenin is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes. CTNNB1 is involved in the regulation of cell adhesion. The majority of beta-catenin is localized to the cell membrane and is part of E-cadherin/catenin adhesion complexes which are proposed to couple cadherins to the actin cytoskeleton.
References
  • Yang, et al. (2002) Linking β-catenin to androgen-signaling pathway. J Biol Chem. 277(13):11336-44.
  • Hino S, et al. (2005) Phosphorylation of β-Catenin by Cyclic AMP-Dependent Protein Kinase Stabilizes β-Catenin through Inhibition of Its Ubiquitination. Mol Cell Biol. 25(20):9063-72.
  • Liu X, et al. (2005) Rapid, Wnt-induced changes in GSK3beta associations that regulate beta-catenin stabilization are mediated by Galpha proteins. Curr Biol. 15(22):1989-97.
  • Kraus C, et al. (1994) Localization of the human β-catenin gene (CTNNB1) to 3p21: a region implicated in tumor development. Genomics. 23(1):272-4.
  • TOP