Mouse BCHE/Butyrylcholinesterase Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009738.3

RefSeq ORF Size

1812bp

Gene Synonym

MGC107651, C730038G20Rik, Bche

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse butyrylcholinesterase Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

References

Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.

Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.

Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.

Catalog Number:HGA765-CY