Human BCAM / CD239 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGA760-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1887bp
Gene Synonym
AU, LU, CD239, MSK19
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human basal cell adhesion molecule (Lutheran blood group), transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein isoforms of the immunoglobulin superfamily representing receptors for the laminin alpha(5) chain. It is a transmembrane receptor with five immunoglobulin-like domains in its extracellular region, and is therefore classified as a member of the immunoglobulin (Ig) gene family. In addition to red blood cells, Lu/BCAM proteins are expressed in endothelial cells of vascular capillaries and in epithelial cells of several tissues. BCAM/LU has a wide tissue distribution with a predominant expression in the basal layer of the epithelium and the endothelium of blood vessel walls. As designated as CD239 recently, BCAM and LU share a significant sequence similarity with the CD146 (MUC18) and CD166, and themselves are adhesion molecules that bind laminin with high affinity. Laminins are found in all basement membranes and are involved in cell differentiation, adhesion, migration, and proliferation. BCAM is upregulated following malignant transformation of some cell types in vivo and in vitro, thus being a candidate molecule involved in tumor progression. In addition, BCAM interacts with integrin in sickle red cells, and thus may potentially play a role in vaso-occlusive episodes.
References
  • Kikkawa Y, et al. (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res. 46 (4-5): 193-9.
  • El Nemer W, et al. (2007) Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell alpha4beta1 integrin: role in adhesion of sickle red blood cells to endothelial cells. Blood. 109 (8): 3544-51.
  • Colin Y, et al. (2008) Red cell and endothelial Lu/BCAM beyond sickle cell disease. Transfus Clin Biol. 15 (6): 402-5.
  • El Nemer W, et al. (2008) Role of Lu/BCAM in abnormal adhesion of sickle red blood cells to vascular endothelium. Transfus Clin Biol. 15 (1-2): 29-33.
  • TOP