Rat BAFFR / TNFRSF13C / CD268 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

XM_576316.3

RefSeq ORF Size

528bp

Gene Synonym

RGD1560810, Tnfrsf13c

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 13c Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

References

Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.

Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.

Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.

Catalog Number:HGA732-NY