Rat Apolipoprotein H/APOH Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001009626.1

RefSeq ORF Size

1038bp

Gene Synonym

Apoh

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat apolipoprotein H (beta-2-glycoprotein I) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is a glycoprotein synthesized by liver cells and it is present in the blood associated with plasma lipoproteins. It is an essential cofactor for the binding of certain antiphospholipid antibodies (APA) to anionic phospholipid. APOH binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. APOH may prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells. APOH appears to completely inhibit serotonin release by the platelets and prevents subsequent waves of the ADP-induced aggregation. The activity of APOH appears to involve the binding of agglutenating, negatively charged compounds, and inhibits agglutenation by the contact activation of the intrinsic blood coagulation pathway. APOH causes a reduction of the prothrombinase binding sites on platelets and reduces the activation caused by collagen when thrombin is present at physiological serum concentrations of APOH suggesting a regulatory role of APOH in coagulation. APOH plasma concentrations are strongly associated to metabolic syndrome alterations and vascular disease in type 2 diabetic and could be considered as a clinical marker of cardiovascular risk. APOH is found on several classes of lipoproteins, and is involved in the activation of lipoprotein lipase in lipid metabolism. This single-chain glycoprotein also has been implicated in several physiologic pathways including coagulation and the production of hypertension, which are related to the pathogenesis of primary cerebral hemorrhage (PICH).

References

Kamboh MI, et al. (1998) Genetics of apolipoprotein H (beta2-glycoprotein I) and anionic phospholipid binding. Lupus. 7 Suppl 2: S10-3.

Singh P, et al. (2002) Genetics of apolipoprotein H (beta2-glycoprotein I) polymorphism in India. Ann Hum Biol. 29(3): 247-55.

Xia J, et al. (2004) Apolipoprotein H gene polymorphisms and risk of primary cerebral hemorrhage in a Chinese population. Cerebrovasc Dis. 17(2-3): 197-203.

Chen Q, et al. (2006) Complete DNA sequence variation in the apolipoprotein H (beta-glycoprotein I) gene and identification of informative SNPs. Ann Hum Genet. 70(Pt 1): 1-11.

Leduc MS, et al. (2008) Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 49(12): 2648-56.

Catalog Number:HGA489-CM