Rat APEX1/APE1/Ref-1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGA464-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
954bp
Gene Synonym
APE, Apex, REF-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat APEX nuclease (multifunctional DNA repair enzyme) 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.
References
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • TOP