Human Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA426-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2022bp
Gene Synonym
ANX6; CBP68
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human annexin A6 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 
References
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • TOP