Mouse Alpha-2-glycoprotein / AZGP1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA363-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
924bp
Gene Synonym
Zag
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse alpha-2-glycoprotein 1, zinc Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be detected in body fluids such as serum, sweat, and seminal and breast cyst fluids. It has been shown that alpha-2-glycoprotein can stimulate lipolysis by adipocytes in vivo and in vitro. Thus it is believed that alpha-2-glycoprotein plays an important role in the regulation of body weight, and age-dependent changes in genetically influenced obesity, and it also regulates melanin production by normal and malignant melanocytes. Alpha-2-glycoprotein is produced by both white and brown fat adipocytes and may act in a local autocrine fashion in the reduction of adiposity in cachexia.
References
  • Tada T, et al. (1991) Immunohistochemical localization of Zn-alpha 2-glycoprotein in normal human tissues. J Histochem Cytochem. 39(9):1221-6.
  • Vanni H, et al. (2009) Cigarette Smoking Induces Overexpression of a Fat-Depleting Gene AZGP1 in the Human. Chest. 135(5):1197-208.
  • Ueyama H, et al. (1991) Cloning and nucleotide sequence of a human Zn-alpha 2-glycoprotein cDNA and chromosomal assignment of its gene. Biochem Biophys Res Commun. 177(2):696-703.
  • TOP