Human ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGA352-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
486bp
Gene Synonym
FLAP, ALOX5AP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human arachidonate 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.
References
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • TOP