Mouse ALDH4A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGA323-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1689bp
Gene Synonym
Ahd1, P5cd, Ahd-1, Aldh4, P5cdh, Ssdh1, P5cdhl, P5cdhs, Aldh5a1, E330022C09, A930035F14Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase 4 family, member A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Additional aldehyde dehydrogenase enzymes detoxify external substances, such as alcohol and pollutants, and internal substances, such as toxins that are formed within cells. ALDH4A1 is expressed abundantly in liver followed by skeletal muscle, kidney, heart, brain, placenta, lung and pancreas. It is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation.
References
  • Goodman SI, et al. (1974) Defective hydroxyproline metabolism in type II hyperprolinemia. Biochemical medicine. 10 (4): 329-36.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138 (1-2): 171-4.
  • Vasiliou V, et al. (2005) Analysis and update of the human aldehyde dehydrogenase (ALDH) gene family. Hum Genomics. 2 (2): 138-43.
  • TOP