Rat AKR1A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA288-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
978bp
Gene Synonym
Akr1a4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.
References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • TOP