Mouse AK2 / Adenylate kinase 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA282-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
Ak-2; D4Ertd220e
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse adenylate kinase 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adenylate kinase 2 (AK2) belongs to the Adenylate kinase family that contains three isozymes: AK1, AK2 and AK3. Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Adenylate kinase2 (AK2) is expressed in mitochondrial intermembrane space. It may play a role in apoptosis. It has been demonstrated that in apoptotic cells AK2 was translocated into the cytosol concomitantly with cytochronme C. Mutations in this gene are the cause of reticular dysgenesis. These mutations result in absent or strongly decreased protein expression. It has been also established that AK2 is specifically expressed in the stria vascularis region of the inner ear, which provides an explanation of the sensorineural deafness in these individuals. 
References
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106-11.
  • Bruns GA, et al. (1977) Adenylate kinase 2, a mitochondrial enzyme. Biochem Genet. 15 (5-6): 477-86.
  • Khler C, et al. (1999) Release of adenylate kinase 2 from the mitochondrial intermembrane space during apoptosis. FEBS Lett. 447 (1): 10-2.
  • TOP