Human AGO1 / Argonaute 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGA249-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2574bp
Gene Synonym
Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2C, 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.
References
TOP