Human ADH7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGA210-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1161bp
Gene Synonym
ADH4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calcium/calmodulin-dependent protein kinase type I I subunit alpha, also known as CaM kinase II subunit alpha, CAMKA, and CAMK2A, is a member of the protein kinase superfamily, CAMK Ser/Thr protein kinase family, and CaMK subfamily. CAMK2A contains one protein kinase domain. CAMK2 is a prominent kinase in the central nervous system that may function in long-term potentiation and neurotransmitter release. As a member of the NMDAR signaling complex in excitatory synapses, it may regulate NMDAR-dependent potentiation of the AMPAR and synaptic plasticity. CAMK2 is composed of four different chains: alpha, beta, gamma, and delta. The different isoforms assemble into homo- or heteromultimeric holoenzymes composed of 8 to 12 subunits. CAMK2 interacts with BAALC, MPDZ, SYN1, CAMK2N2 and SYNGAP1.
References
  • Nagase T., et al., 1999, DNA Res. 6: 63-70.
  • Schmutz J., et al., 2004, Nature. 431: 268-274.
  • Krapivinsky G., et al., 2004, Neuron 43:563-574. 
  • Ignotz,GG. et al., 2005, Biol Reprod. 73 (3): 519-26.
  • TOP