Mouse ACTA2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007392.3

RefSeq ORF Size

1134bp

Gene Synonym

Actvs; a-SMA; SMalphaA; alphaSMA; 0610041G09Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse actin, alpha 2, smooth muscle, aorta Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Actins are globular multi-functional proteins which can be detected in all eukaryotic cells. In vertebrates, there are three main groups of actins that possess slightly different functions: alpha, beta, and gamma. The alpha actins, found in muscle tissues, are a major constituent of the contractile apparatus. Beta-actin, found at the expanding edge of cells, uses the projection of its cellular structure as its mean of mobility. Gamma-actin is found in the filaments of stress fibres. ACTA2 is an alpha actin that is found in skeletal muscle. Expression of alpha skeletal, alpha cardiac, alpha vascular, and gamma enteric actins are restricted to specialized muscle cell type. Smooth muscle alpha actin is of further interest because it is one of a few genes whose expression is relatively restricted to vascular smooth muscle cells. Further more, expression of smooth muscle alpha actin is regulated by hormones, cell proliferation, and altered by pathological conditions including oncogenic transformation and atherosclerosis.

References

Ueyama H, et al., 1990, Jinrui Idengaku Zasshi. 35(2): 145-50.

Snásel J, et al., 1997, Folia Biol. 42(5): 227-30.

Adams LD, et al., 1992, AIDS Res Hum. 8(2): 291-5.

Catalog Number:HGA164-NY