Mouse ACPL2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGA152-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1443bp
Gene Synonym
BB177120, MGC38214, 9430094M07Rik, C130099A20Rik, DKFZp434B2119, Acpl2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse acid phosphatase-like 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.
References
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • TOP