Human AARSD1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGA068-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578bp
Gene Synonym
MGC2744, AARSD1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human PTGES3L-AARSD1 readthrough Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
AARSD1 belongs to the class-II aminoacyl-tRNA synthetase family, Alax-L subfamily. AARSD1 binds 1 zinc ion per subunit functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Four transcript variants have been described for AARSD1: NM_025267.3, NM_001136042.2, NM_001142653.1 and NM_001142654.1. It has been determined that the latter two variants represent a distinct upstream locus, which is now represented by GeneID:100885848 (PTGES3L), while the former two variants represent readthrough transcripts between PTGES3L and this locus (AARSD1). The readthrough locus (PTGES3L-AARSD1) is now represented by GeneID:100885850.
References
  • Tatham MH, et al. (2011) Comparative proteomic analysis identifies a role for SUMO in protein quality control. Oncogene. 19(17):2120-8.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • TOP